View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15332_low_3 (Length: 238)
Name: NF15332_low_3
Description: NF15332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15332_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 28 - 221
Target Start/End: Complemental strand, 29209564 - 29209371
Alignment:
| Q |
28 |
tgaagctacttatgatgttatttatcattcagcatgctgtgataaatgtgagtgctatgtaaaagaaggtcaattgtttcctcaatgtatttgtagagat |
127 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
29209564 |
tgaagatacttatgatgttatttatcattcagcatgctgtgataaatgtgagtgctatgtgaaagaaggtcatttttttcctcaatgtatttgtagagat |
29209465 |
T |
 |
| Q |
128 |
gatggatgtcactcagcttgcaaaaaatgtgattgcattagagattcagaatcagagactccttcttgttattgtgcagatgtcatgtttttca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29209464 |
gatggatgtcactcagcttgcaaaaaatgtgattgcattagagattcagaatcagaaactccttcttgttattgtgcagatgtcatgtttttca |
29209371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 29209630 - 29209601
Alignment:
| Q |
1 |
caccgcaactattgttgatgctcgttttga |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29209630 |
caccgcaactattgttgatgctcgttttga |
29209601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University