View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15333_high_3 (Length: 301)
Name: NF15333_high_3
Description: NF15333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15333_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 30695804 - 30695564
Alignment:
| Q |
7 |
gttatctcattaaaatcgaacaatccatatttaaagaaaatttcttctttttatagtcgaaaaatagagttttaaatatgaagtgttcgatcttaatcgg |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30695804 |
gttatcttattaaaatcgaacaatccatatttaaagaaaatttcttctttttatagtctaaaaatagagttttaaatatgaaaagttcgatcttaatcgg |
30695705 |
T |
|
| Q |
107 |
aatnnnnnnnnntgaactcactgcaattgcatattattcaattgattttgcacgaatcttgccattatttaatgtgtatgaagccgtggaatgaaatgat |
206 |
Q |
| |
|
||| ||||| |||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30695704 |
aatacaaaaaa-tgaacgcactacaattgcatattattcagttgattttgcaggaatcttgccattatttaatgtgtatgaagccgtggaatgaaatgat |
30695606 |
T |
|
| Q |
207 |
caaggtcgtgttttaattagagtgttaactatttgaccaaat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30695605 |
caaggtcgtgttttaattagagtgttaactatttggccaaat |
30695564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 233 - 291
Target Start/End: Complemental strand, 30695545 - 30695487
Alignment:
| Q |
233 |
aactatttgaccaaataaaacctaccttgtgagatagtgatccattgctaccccctttg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30695545 |
aactatttgaccaaataaaacctaccttgtgagatagtgatccattgctaccccctttg |
30695487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University