View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15333_low_9 (Length: 250)
Name: NF15333_low_9
Description: NF15333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15333_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 16 - 126
Target Start/End: Original strand, 5940948 - 5941058
Alignment:
| Q |
16 |
atgaacagaaatagatgtgtgaaattaggtcatatgtcatcatggnnnnnnngttcttacaaagaatatgctatgatcaattattatagtttagctactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5940948 |
atgaacagaaatagatgtgtgaaattaggtcatatgtcatcagggaaaaaaagttcttccaaagaatatgctatgatcaaatattatagtttagctactc |
5941047 |
T |
 |
| Q |
116 |
tgatccatttt |
126 |
Q |
| |
|
||||||||||| |
|
|
| T |
5941048 |
tgatccatttt |
5941058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 104 - 225
Target Start/End: Original strand, 5905131 - 5905252
Alignment:
| Q |
104 |
gtttagctactctgatccattttgtaagtttacccatgaatcacaaccgaactaatgacaaatgggcgaagatgaagctcaaaggacacacactcttgtt |
203 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||| ||| | | ||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
5905131 |
gtttaactactctggtccattttgtaagtttacccatgaatcgcaaacacattaatgacaaatgggcgaaggcaaagctcaaagaacacacactcttgtt |
5905230 |
T |
 |
| Q |
204 |
ccactatactcaagcaactata |
225 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
5905231 |
ccactatactcaagcaattata |
5905252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 57
Target Start/End: Original strand, 5904985 - 5905018
Alignment:
| Q |
24 |
aaatagatgtgtgaaattaggtcatatgtcatca |
57 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
5904985 |
aaatagatgtgtgaaattaggtcaaatgtcatca |
5905018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 208
Target Start/End: Original strand, 5917935 - 5917967
Alignment:
| Q |
176 |
tgaagctcaaaggacacacactcttgttccact |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
5917935 |
tgaagctcaaaggacacacactcttgctccact |
5917967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University