View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15338_high_5 (Length: 249)
Name: NF15338_high_5
Description: NF15338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15338_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 16729819 - 16729589
Alignment:
| Q |
1 |
acacgtagcttttggagcttctggaggcatccgatggagtcgggcaatgttttgatattgttatagctaacatctagttcaactagggacaagaggagtc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16729819 |
acacttagcttttggagcttctggaggcatccgatggagtcgggcaatgttttgatattgttgtagctaacatctagttcaactagggacaagaggagtc |
16729720 |
T |
 |
| Q |
101 |
ctatggagtagggcaatgactccaagtaccggaaattctgactcacattcagggtttcaagattgacgaggttctcaaggtcgtcggggagactcctgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16729719 |
ctatggagtagggcaatgactccaagtaccgaaaattctgactcacattcagggtttcaagattgacgaggttctcaaggtcgtcggggagactcctgag |
16729620 |
T |
 |
| Q |
201 |
gcagttcaaacgtacgtcgagaaccataaga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16729619 |
gcagttcaaacgtacgtcgagaaccataaga |
16729589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University