View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15338_low_10 (Length: 267)
Name: NF15338_low_10
Description: NF15338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15338_low_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 8 - 267
Target Start/End: Complemental strand, 16730075 - 16729816
Alignment:
| Q |
8 |
gagatgaagaggcgacaacctccccatgaagcctggtgaagcaagaccattcatgggttgataatgaagcttgtggaaacccttatgttctgaacgtttc |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16730075 |
gagacgaagaggcgacaacctccccatgaagcctggtgaagcaagaccattcatgggttgataatgaagcttgtggaaacccttatgttctgaacgtttc |
16729976 |
T |
 |
| Q |
108 |
atttctccattgaaggtcccacatttcaccatccaccatctctttttggttgggatatgatggcttgagttcattttgttgcacatgtactcttttacca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16729975 |
atttctccattgaaggtcccacatttcaccatccaccatctctttttggttgggatatgatggcttgagttcattttgttgcacatgtactcttttacca |
16729876 |
T |
 |
| Q |
208 |
catgcaatccctgctccaccacctcctgtggaggcgaaatgagtgggtttccctccacac |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16729875 |
catgcaatccctgctccaccacctcctgtggaggcgaaatgagtgggtttccctccacac |
16729816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University