View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15338_low_7 (Length: 371)
Name: NF15338_low_7
Description: NF15338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15338_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 1 - 359
Target Start/End: Complemental strand, 48430640 - 48430282
Alignment:
| Q |
1 |
tttatcaatgcttttgattcaattttctctgtgcatatttgaattcttcaacatcaacaggtggccaggggtaaggcaattttggctcgtgcaagggaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
48430640 |
tttatcaatgcttttgattcaattttctctgtgcatatttgaattcttcaacatcaacaggtggccaggggaaaggcaattttggctagtgcaagggaac |
48430541 |
T |
 |
| Q |
101 |
ttgaggatgaattatttggagagatgcaaacagttggaggctgagttacataaagggtgtcagaatagtcaactgatggggtcgtttgccaatgcatttt |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48430540 |
ttgaggctgaattatttggagagatgcaaacagttggaggctgagttacatgaagggtgtcagaatagtcaactgatggggtcgtttaccaatgcatttt |
48430441 |
T |
 |
| Q |
201 |
acacaggagctcccaccgtgaaccccgttgtcttctttccttcattagtatattttannnnnnnataactcctattagtttttagatgtcccatttaaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48430440 |
acacaggagctcccaccgtgaaccccgtcgtcttctttccttcattagtatattttatttttttataactcctattggtttttagatgtcccatttaaag |
48430341 |
T |
 |
| Q |
301 |
gactgttcatacactcttgttcaaaaaaggtctgttcatacactgctttgtgtctagta |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48430340 |
gactgttcatacactcttgttcaaaaaaggtctgttcatacactgctttgtgtctagta |
48430282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University