View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1533_low_2 (Length: 236)
Name: NF1533_low_2
Description: NF1533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1533_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 577096 - 577304
Alignment:
| Q |
12 |
tcttgtgaaggattgcatgccctattaagaaactcaccttttctagagaaaattgagtttaaggtggtaacctaacttggatcaattataaattaaaagt |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
577096 |
tcttgtgaaggattgcattccctattaagaaactcaccttttctagagaaaattgagtttaaggaggtaacctaacttggatcaattataaattaaaagt |
577195 |
T |
|
| Q |
112 |
tgtacttatattttagttacacattatatgctcgtgattgtatataaatatgttttgctaatatatataaccaattattgtaggggatcactttggctgc |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
577196 |
tgtactgatattttagttacacattatatgctcgtgattgtatataaatatgttttgctaatatatataaccaattattgtaggggatcactttggctgc |
577295 |
T |
|
| Q |
212 |
aaatggtgg |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
577296 |
aaatggtgg |
577304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University