View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1533_low_4 (Length: 210)
Name: NF1533_low_4
Description: NF1533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1533_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 34384620 - 34384797
Alignment:
| Q |
17 |
atcatggaggttgttgcaagaattgttggagcctgcacttctgaactttacattttccttaatgtctattagccttgttgcaaacctaataaatagtaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384620 |
atcatggaggttgttgcaagaattgttggagcctgcacttctgaactttacattttccttaatgtctattagccttgttgcaaacctaataaatagtaaa |
34384719 |
T |
|
| Q |
117 |
agatgtcggcagaggactaagaaatggaagggaaaaaatgtgatctcaattgaaatgagagacttactgggttccttc |
194 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34384720 |
agatgtcggcagaggactaagaaattgaagggaaaaaatgtgatctcaattgtaatgagagacttactgggttccttc |
34384797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University