View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15341_low_16 (Length: 281)
Name: NF15341_low_16
Description: NF15341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15341_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 114 - 259
Target Start/End: Complemental strand, 45102736 - 45102601
Alignment:
| Q |
114 |
attattctaatttaatttattactagtaacgctcatgttagagttactagtaataattctcacattattagtacaaataattctaacattatttatatcg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45102736 |
attattcgaatttaatttattactagtaacgctcatgttagagttactagtaataattctcacattattagtacaaataattctaaaattatttata--- |
45102640 |
T |
|
| Q |
214 |
ttcctttcatacgatctagtatgattggaatatacagtaataaatg |
259 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45102639 |
ttc-------acgatctagtatgattggaatatacagtaataaatg |
45102601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University