View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15341_low_20 (Length: 230)
Name: NF15341_low_20
Description: NF15341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15341_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 214
Target Start/End: Complemental strand, 26430613 - 26430411
Alignment:
| Q |
12 |
tgatatgaaaagttgattggtttgaggttctgaattctaatgaaatatattgttatccttattaaaggtgataatgagctagtgaagctgaaatttgctg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26430613 |
tgatatgaaaagttgattggtttgaggttctgaattctaatgaaatatattgttatccttattaaaggtgataatgagctagtgaagctgaaatttgctg |
26430514 |
T |
 |
| Q |
112 |
ctgaagaaagggaaaagtttcacagtgatgaaaagtgcagagctgcaaatgttatagaagagaagggtgagagttaaattgcaaatgactattttgaaga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26430513 |
ctgaagaaagggaaaagtttcacagtgatgaaaagtgcagagctgcaaatgttatagaagagaagggtgagagttaaattgcaaatgactattttgaaga |
26430414 |
T |
 |
| Q |
212 |
aat |
214 |
Q |
| |
|
||| |
|
|
| T |
26430413 |
aat |
26430411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University