View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_high_38 (Length: 239)
Name: NF15342_high_38
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 29476837 - 29477042
Alignment:
| Q |
15 |
gaaacgggaaagggtgggttgcactgctgtggaaacggacaaaatacccaaaatttggagatattgtcattgtggctgggttccatagacgaaaatatcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29476837 |
gaaacgggaaagggtgggttgcactgccatggaaacggacaaaatacccaaaatttggagatattgtcattgtggctgggttccatagacgaaaatatcc |
29476936 |
T |
|
| Q |
115 |
caattgagaatcaccgccagccaaaagaatcaatccattgcagctaccaatcattaaagaacattctttatcacccaaatgatggtaaggatcgaccgaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29476937 |
caattgagaatcaccgccagccaaaagaatcaatccattgcagctaccaatcattaaagaacattctttatcacccaaatgatggtaaggatcgaccgaa |
29477036 |
T |
|
| Q |
215 |
agggtg |
220 |
Q |
| |
|
|||||| |
|
|
| T |
29477037 |
agggtg |
29477042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 57 - 220
Target Start/End: Original strand, 29480018 - 29480181
Alignment:
| Q |
57 |
aatacccaaaatttggagatattgtcattgtggctgggttccatagacgaaaatatcccaattgagaatcaccgccagccaaaagaatcaatccattgca |
156 |
Q |
| |
|
|||| ||||||||||||| ||| |||||| ||||||||||||||| |||||||| | ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29480018 |
aatagccaaaatttggaggaatttccattgttgctgggttccatagatgaaaatattcaaattgtgaatcaccgccagccaaaagaatcaatccattgca |
29480117 |
T |
|
| Q |
157 |
gctaccaatcattaaagaacattctttatcacccaaatgatggtaaggatcgaccgaaagggtg |
220 |
Q |
| |
|
| || ||| ||| | || |||| |||||||| |||||||| ||| ||||| || ||||||||| |
|
|
| T |
29480118 |
ggtatcaaccatacaggagcattgtttatcactcaaatgatagtacggatctacggaaagggtg |
29480181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 124 - 216
Target Start/End: Original strand, 29446256 - 29446348
Alignment:
| Q |
124 |
atcaccgccagccaaaagaatcaatccattgcagctaccaatcattaaagaacattctttatcacccaaatgatggtaaggatcgaccgaaag |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||| || |||||||| ||| || | |||||||| ||||||||| || ||||| |
|
|
| T |
29446256 |
atcaccgccagccaaaagaatcaaaccattgcagttaccaactatagaagaacatccttgatagctcaaatgatagtaaggatccacggaaag |
29446348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University