View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_high_41 (Length: 221)
Name: NF15342_high_41
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 17 - 168
Target Start/End: Original strand, 6941358 - 6941509
Alignment:
| Q |
17 |
actatataattgtattttaaatatgctgcttccagcactactttaaattttggcatactacaaattaaaatcagtgttacttatgcaagtgacgccaaaa |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6941358 |
actatataattgcattttaaatatgctgcttccagcactacttgaaattttagcatactacaaattaaagtcagtgttacttatgcaagtgacgccaaaa |
6941457 |
T |
 |
| Q |
117 |
tgacataatcttgtctcttttcattctttgtcctctcatgaacacattactg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6941458 |
tgacataatcttgtctcttttcattctttgtcctctcatgaacacattactg |
6941509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University