View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15342_high_42 (Length: 208)

Name: NF15342_high_42
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15342_high_42
NF15342_high_42
[»] chr4 (1 HSPs)
chr4 (12-190)||(8498718-8498896)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 8498896 - 8498718
Alignment:
12 attattctctaaagtagaaacttcggattttatgctactccaaagagaagaaaaaatgtgatgagtgataaccctcttacctctgaagactttacttctc 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||    
8498896 attattctctaaagtagaaacttcggattttatgctactccaaagagaagaaaaaatgtgatgagtgataactctcttacctctgaagacttgacttctc 8498797  T
112 aacaacaaagccgaatcttcattagagttcttcagatcccataaaatcttcagattggtggcttcattcaaagtaatta 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
8498796 aacaacaaagccgaatcttcattagagttcttcagatcccataaaatcttcaaattggtggcttcattcaaagtaatta 8498718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University