View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_high_42 (Length: 208)
Name: NF15342_high_42
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 8498896 - 8498718
Alignment:
| Q |
12 |
attattctctaaagtagaaacttcggattttatgctactccaaagagaagaaaaaatgtgatgagtgataaccctcttacctctgaagactttacttctc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
8498896 |
attattctctaaagtagaaacttcggattttatgctactccaaagagaagaaaaaatgtgatgagtgataactctcttacctctgaagacttgacttctc |
8498797 |
T |
 |
| Q |
112 |
aacaacaaagccgaatcttcattagagttcttcagatcccataaaatcttcagattggtggcttcattcaaagtaatta |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8498796 |
aacaacaaagccgaatcttcattagagttcttcagatcccataaaatcttcaaattggtggcttcattcaaagtaatta |
8498718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University