View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_low_17 (Length: 411)
Name: NF15342_low_17
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_low_17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 18 - 411
Target Start/End: Complemental strand, 40839107 - 40838714
Alignment:
| Q |
18 |
ggttttaaattgtggtttaggtgtgattgttcttatacaacaaatattttttacaccgtcaatcaaaataccatcacgagatcataaaattgcttgacat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40839107 |
ggttttaaattgtggtttaggtgtgattgttcttatacaacaaatattttttacaccgtcaatcaaaataccatcgcgagatcataaaattgcttgacat |
40839008 |
T |
|
| Q |
118 |
ttatcataattacttctcccattatacatataataatatattgattgtgaatgtgatttattgacgaaaaatcttatttatgtattgaaatttaggtaca |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839007 |
ttatcataactacttctcccattatacatataataatatactgattgtgaatgtgatttattgacgaaaaatcttatttatgtattgaaatttaggtaca |
40838908 |
T |
|
| Q |
218 |
tggagttctaaacattatagggtggggaacattgttacctatgggagtaataattccaagatactttcgagtgtatccttttaaaaaggatccatggtgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
40838907 |
tggagttctaaacattatagggtggggaacgttgttacctatgggagtaataattccaagatactttcgagtgtatccttttcacaaggatccatggtgg |
40838808 |
T |
|
| Q |
318 |
ttttacttgcacattggttgccaaacaactggttttctcattggtactgctggttgggctattggattggttcttggacattcttctagatact |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40838807 |
ttttacttgcacattggttgccaaacaactggttttctcattggtactgctggttgggttattggattggttcttggacattcttctagatact |
40838714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University