View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_low_21 (Length: 398)
Name: NF15342_low_21
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 22 - 389
Target Start/End: Original strand, 34105106 - 34105473
Alignment:
| Q |
22 |
attgtaagcatgggtttgcaaggtttgatgtgatctctggaggatgttcgaagattgtttatttttctttccaaataccgtctgtattatattatactct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34105106 |
attgtaagcatgggtttgcaaggtttgatgtgatctctggaggatgttcgaagattgtttatttttctttccaaataccgtctgtattatattatactct |
34105205 |
T |
 |
| Q |
122 |
ttgatgtagatgtagcctttcgactgttttagaggttattctcccatttgggtgcgggggatcacatcatcacaacaaacattgagctccaatatttaac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34105206 |
ttgatgtagatgtagcctttcgactgttttagaggttattctcccatctgggtgcgggagatcacaccatcacaacaaacattgagctccaatatttaac |
34105305 |
T |
 |
| Q |
222 |
ttatatttcaagttactaagttgatagaactaattagtttacatttctgtttagttgatactactattgtgtaaaaacatgaaattgtatgtgcttgatc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34105306 |
ttatatttcaagttactaagttgatagaactaattagtttacatttctgtttagttgatactactattgtgtaaaaacatgaaattgtatgtgcttgatc |
34105405 |
T |
 |
| Q |
322 |
aatcattagtgtgacatgaaatagattgaagaaactgtgatgtcttttcctttggtgcctttgcttct |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
34105406 |
aatcattagtgtgacatgaaatagattgaagaaactgtgatgtcttttcctttggtgtctttgtttct |
34105473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University