View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_low_34 (Length: 310)
Name: NF15342_low_34
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_low_34 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 112 - 310
Target Start/End: Original strand, 42824440 - 42824638
Alignment:
| Q |
112 |
aatctaaagtactctaatcaacaaaacataacgtaattgataagtatctccgtgcgaacagttacagttatgttataagattttccagttctaagtataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42824440 |
aatctaaagtactctaatcaacaaaacataacgtaattgataagtatctccgtgcgaacagttacagttatgttataagattttccagttctaagtataa |
42824539 |
T |
 |
| Q |
212 |
acaaatcaattttctgagcaaatctcaacaaaatttcttagaatcctaacaatggcggatccaatcccagcgcatcacagatccaccacaaaccacttc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42824540 |
acaaatcaattttctgagcaaatctcaacaaaatttcttagaattctaacaatggcggatccaatcccagcgcatcacagatccaccacaaacctcttc |
42824638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University