View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_low_38 (Length: 291)
Name: NF15342_low_38
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 7e-52; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 1696157 - 1696050
Alignment:
| Q |
1 |
ctcgtttggactgttcatctcaccagcgtaatcaattaaactctctctttctctgtttattactttgttttggtgtttacgtgaatatagcgtaatttgt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1696157 |
ctcgtttggactgttcttctcaccagcgtaatcaattaaactctctctttctctgtttattactttgttttggtgtttacgtgaatatagcgtaatttgt |
1696058 |
T |
|
| Q |
101 |
tatgctat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
1696057 |
tatgctat |
1696050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 168 - 240
Target Start/End: Complemental strand, 1695981 - 1695909
Alignment:
| Q |
168 |
atgaaagaatcaaccttagtataccagctatatttagatcaacgattagtctgacataatcatagtttatcac |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1695981 |
atgaaagaatcaaccttagtatacctgctatatttagatcaacgatgagtctgacataatcatagtttatcac |
1695909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 1685608 - 1685520
Alignment:
| Q |
1 |
ctcgtttggactgttcatctcaccagcgtaatcaattaaactctctctttctctgtttattactttgttttggtgtttacgtgaatata |
89 |
Q |
| |
|
|||||||||||||||| || |||||| |||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
1685608 |
ctcgtttggactgttcttcgcaccagggtaactaattaaactctctctttctctatttattactttgttttgttgtttacgtgaatata |
1685520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 1685447 - 1685404
Alignment:
| Q |
170 |
gaaagaatcaaccttagtataccagctatatttagatcaacgat |
213 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1685447 |
gaaagaatcaacctaagtataccagctatatttagatcaacgat |
1685404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University