View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_low_42 (Length: 250)
Name: NF15342_low_42
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 236
Target Start/End: Complemental strand, 32969959 - 32969730
Alignment:
| Q |
7 |
aatataagtgtccactattttctagccatacatcacacaaaagtatgctcattgtacgtagagtataaaatcacatctcactatttatatataccataac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32969959 |
aatataagtgtccactattttctagccatacatcacacaaaagtatgctcattgtacgtagagtataaaatcacatctcactatttatatataccataac |
32969860 |
T |
|
| Q |
107 |
attatttgctaaaatatcaatattaatataaaaatgatgaaatcttgttagttatatatccatacaactgattaatattgcgaatgcatacactgttttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32969859 |
attatttgctaaaatatcaatattaatataaaaatgatgaaatcttgttagttatatatccatacaactgattaatattgcgaatgcatacactgttttt |
32969760 |
T |
|
| Q |
207 |
ggtagaaaaagaagaattaatcttattttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32969759 |
ggtagaaaaagaagaattaatcttattttt |
32969730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University