View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15342_low_49 (Length: 235)
Name: NF15342_low_49
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15342_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 30746745 - 30746961
Alignment:
| Q |
1 |
agtcgagtgaagttaatgtgtcacatcatcttcttagagctaaccaaacaccaccatagcaggcaatcatatcctactacatgtcatcacaaacacaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30746745 |
agtcgagtgaagttaatgtgtcacatcatcttgttagc-ctaaccaaacaccactatagcaggcaatcatatcctactacatgtcatcaaaaacacaaca |
30746843 |
T |
 |
| Q |
101 |
cctcaactcacaaggtcatgtcattatccc-tgacgtgctaaccacttgattcaataatggaattatttcttttgtttccattcataacaaaaatctaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30746844 |
cctcaactcacaaggtcatgtcattatcccctgacgtgctaaccacttgattcaataatggaattatttcttttgtttccattcataacaaaaatctaat |
30746943 |
T |
 |
| Q |
200 |
catttgactcatgacatt |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30746944 |
catttgactcatgacatt |
30746961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University