View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15343_high_16 (Length: 322)
Name: NF15343_high_16
Description: NF15343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15343_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 13 - 302
Target Start/End: Original strand, 45098570 - 45098859
Alignment:
| Q |
13 |
aatattatgagaggaataaaagtaccaagtccataatctctattagaaaatttcaatctcatccacttaatgataatttggattccaatcatgtgctccc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098570 |
aatattatgagaggaataaaagtaccaagtccataatctctattagaaaatttcaatctcatccacttaatgataatttggattccaatcatgtgctccc |
45098669 |
T |
 |
| Q |
113 |
tgaagtagaggccattggcatagaatcagagaaggaattattacttattaaaatcaactgtgagaaacgtgaaggcattttgttcaaactattgtctatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098670 |
tgaagtagaggccattggcatagaatcagagaaggaattattacttattaaaatcaactgtgagaaacgtgaaggcattttgttcaaactattgtctatg |
45098769 |
T |
 |
| Q |
213 |
ctggaaaatatgcacctctatgtttccaccagtagtgtgcttccatttgggaaaaataccctcaacattaccatcattgctaaggtaatg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098770 |
ctggaaaatatgcacctctatgtttccaccagtagtgtgcttccatttgggaaaaataccctcaacattaccatcattgctaaggtaatg |
45098859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University