View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15343_high_21 (Length: 266)
Name: NF15343_high_21
Description: NF15343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15343_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 34042608 - 34042856
Alignment:
| Q |
1 |
aacccctcatgacattctttttcgcaatcttgctgtttctataatcgccaaggtcagtcatcatttcgagcttcgttttcttgaatttcatcatcgattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34042608 |
aacccctcatgacattctttttcgcaatcttgctgtttctataatcgccaaggtcagtcatcatttcgagcttcgttttcttgaatttcatcatcgattc |
34042707 |
T |
 |
| Q |
101 |
attgagaaaattcatgtcatttgcatgctcgattcatgatttgaagctttgttttcgttgattttgctgagttgaatctgttccgttgtgttagattctt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34042708 |
attgagaaaattcatgccatttgcatgctcgattcatgatttgaagctttgttttcgttgattttgctgagttgaatctgttccgttgtgttagattctt |
34042807 |
T |
 |
| Q |
201 |
ctcccgctttgtgtttcatgagaaatttcttttattctgttattaattt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34042808 |
ctcccgctttgtgtttcatgagaaatttcttttattctgttattaattt |
34042856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 85
Target Start/End: Complemental strand, 4046531 - 4046456
Alignment:
| Q |
10 |
tgacattctttttcgcaatcttgctgtttctataatcgccaaggtcagtcatcatttcgagcttcgttttcttgaa |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
4046531 |
tgacattctttttcgcaatcttgctgtttctgtaatcgtcaaggtcagtcatcattttgagctttgttttcttgaa |
4046456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University