View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15343_high_23 (Length: 263)
Name: NF15343_high_23
Description: NF15343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15343_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 52597209 - 52596969
Alignment:
| Q |
9 |
gagtgagatgaagttcggaggtggagcagaaggataaaggggaaaaggtaagttgctttggaatggaagaagaaaaagaatacaatggaagtggtgcggc |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52597209 |
gagtgagatggagttcggaggtggagcagaaggataaaggggaaaaggtaagttgctttggaatggaagaagaaaaagaatacaatggaagtggtgcggc |
52597110 |
T |
 |
| Q |
109 |
agtggaaaacgccatccagggtagtcgccgaagcagcattttctcacttttctattaaaattggaacgcaaacaccgatatttctgggattcggattatc |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52597109 |
ggtggaaaacgccatccagggtaatcgccgaagcagcattttctcacttttctgttgaaattggaacgcaaacaccgatatttctgggattcggattatc |
52597010 |
T |
 |
| Q |
209 |
aaataagaacgatac-----cccctattttcatctgtcttt |
244 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52597009 |
aaataagaacgatacttaaacccctattttcatctgtcttt |
52596969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University