View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15343_low_15 (Length: 370)
Name: NF15343_low_15
Description: NF15343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15343_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 1e-35; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 269 - 357
Target Start/End: Original strand, 34465447 - 34465535
Alignment:
| Q |
269 |
cgttaatttaataaactatttttactgaataaattaatatccttttttcaatggaaaatttgcaaaaataataccctaccttcatctca |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
34465447 |
cgttaatttaataaactatttttactgaataaattaatatccttttttcaatggcaaatttggaaaaataataccctaccttcctctca |
34465535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 23 - 105
Target Start/End: Original strand, 34465193 - 34465276
Alignment:
| Q |
23 |
ctattatcaaataatcgagtttttaaaataattaaaaccatagccatattttttg-agtcataattaaaaggtaaagatgaaag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34465193 |
ctattatcaaataatcgagtttttaaaataattaaaaccattgccatattttttgaagtcataattaaaaggtaaagatgaaag |
34465276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 274 - 349
Target Start/End: Original strand, 34481593 - 34481669
Alignment:
| Q |
274 |
atttaataaac-tatttttactgaataaattaatatccttttttcaatggaaaatttgcaaaaataataccctacct |
349 |
Q |
| |
|
||||||||||| | |||||||||| |||||||||||||| |||||||||| || |||| ||||||||||| |||||| |
|
|
| T |
34481593 |
atttaataaacctttttttactgactaaattaatatcctcttttcaatggcaactttggaaaaataatactctacct |
34481669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University