View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15343_low_18 (Length: 315)
Name: NF15343_low_18
Description: NF15343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15343_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 139 - 304
Target Start/End: Complemental strand, 37627724 - 37627559
Alignment:
| Q |
139 |
atattttaataatctgatttgttcaacttaattttcttagatttattagtctaaatcagagcttgtgtttattttgggttcctttgttgaattgtcataa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37627724 |
atattttaataatctgatttgttcaacttaattttcttagatttattagtctaaatcagagcttgtgtttattttgggttcatttgttgaattgtcataa |
37627625 |
T |
 |
| Q |
239 |
acacttggcatggacccactagatggctgttttttcctcttgaagatttgaccaaatacaaccaca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
37627624 |
acacttggcatggacccactagatggctgttttttcctcttgaatatttgaccaaattcaaccaca |
37627559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 12 - 147
Target Start/End: Complemental strand, 37628624 - 37628489
Alignment:
| Q |
12 |
aaactcttgttgtatgcttttctttctccaagtttattgtaggttgcttgctttatgatgcatattagagttctttataaggtggtatttatagaccaac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37628624 |
aaactcttgttgtatgcttttctttctccaagtttattgtaggttgcttgctttatgatgcatattagagttctttataaggtggtatttatagaccaac |
37628525 |
T |
 |
| Q |
112 |
aaaatcttattttaaatctaattgaatatattttaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37628524 |
aaaatcttattttaaatctaattgaatatattttaa |
37628489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University