View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15343_low_19 (Length: 281)
Name: NF15343_low_19
Description: NF15343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15343_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 75 - 221
Target Start/End: Complemental strand, 30817247 - 30817101
Alignment:
| Q |
75 |
aacctcctactctgtttcttgaggcgttgcaagggaagccagctatttgcggacgtttgcaagtggcaaagctacatatcaatctcaattctcaagttgc |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30817247 |
aacctcctactctgtttcttgagccgttgcaagggaagccagctatttgcggacgtttgcaagtggcaaagctacatatcaatctcaattctcaagttgc |
30817148 |
T |
 |
| Q |
175 |
aagggaagtcatgtgtttcattaaattttcttttttacgcagaacac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30817147 |
aagggaagtcatgtgtttcattaaattttcttttttacgcagaacac |
30817101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 84 - 169
Target Start/End: Complemental strand, 30805463 - 30805378
Alignment:
| Q |
84 |
ctctgtttcttgaggcgttgcaagggaagccagctatttgcggacgtttgcaagtggcaaagctacatatcaatctcaattctcaa |
169 |
Q |
| |
|
|||||||||| ||||| |||| | |||||||||||||||| |||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
30805463 |
ctctgtttctagaggccatgcatgagaagccagctatttgcagacgtttgcaagtggcaaggttgcatatcaatctcaattctcaa |
30805378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 265
Target Start/End: Complemental strand, 30817087 - 30817054
Alignment:
| Q |
232 |
atgcagtcattaaagatatttatacacacagtat |
265 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
30817087 |
atgcagccattaaagatatttatacacacagtat |
30817054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University