View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15343_low_24 (Length: 263)

Name: NF15343_low_24
Description: NF15343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15343_low_24
NF15343_low_24
[»] chr3 (1 HSPs)
chr3 (9-244)||(52596969-52597209)


Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 52597209 - 52596969
Alignment:
9 gagtgagatgaagttcggaggtggagcagaaggataaaggggaaaaggtaagttgctttggaatggaagaagaaaaagaatacaatggaagtggtgcggc 108  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52597209 gagtgagatggagttcggaggtggagcagaaggataaaggggaaaaggtaagttgctttggaatggaagaagaaaaagaatacaatggaagtggtgcggc 52597110  T
109 agtggaaaacgccatccagggtagtcgccgaagcagcattttctcacttttctattaaaattggaacgcaaacaccgatatttctgggattcggattatc 208  Q
     |||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||    
52597109 ggtggaaaacgccatccagggtaatcgccgaagcagcattttctcacttttctgttgaaattggaacgcaaacaccgatatttctgggattcggattatc 52597010  T
209 aaataagaacgatac-----cccctattttcatctgtcttt 244  Q
    |||||||||||||||     |||||||||||||||||||||    
52597009 aaataagaacgatacttaaacccctattttcatctgtcttt 52596969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University