View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15343_low_28 (Length: 246)
Name: NF15343_low_28
Description: NF15343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15343_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 25334001 - 25333854
Alignment:
| Q |
1 |
ttttttaggttatcgtcttattagtctgaaatttccaacactatgtaaaaatgactaatcactattgagaaacttgtgaagcatataagatgtgtttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25334001 |
ttttttaggttatcgtcttattagtccaaaatttccaacactatgtaaaaatgactaatcactattgagaaacttgtgaagtatataagatgtgtttttc |
25333902 |
T |
|
| Q |
101 |
tatcgcaactgaactttcatacatacgcacgagtcagaaatcaaacat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25333901 |
tatcgcaactgaactttcatacatacgcacgagtcagaaatcaaacat |
25333854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 183 - 244
Target Start/End: Complemental strand, 25333758 - 25333697
Alignment:
| Q |
183 |
tacttattgatgctaccttgtacttgtacaattagtcccattcttgcaccccctatgcttct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
25333758 |
tacttattgatgctaccttgtacttgtactattagtcccattcttgcaccccttatgcttct |
25333697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 136 - 185
Target Start/End: Complemental strand, 25333839 - 25333790
Alignment:
| Q |
136 |
agaaatcaaacatctaaccaattgctaaagtggtccaaatctcctactac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25333839 |
agaaatcaaacatctaaccaattgctaaagtggtccaaatctcctactac |
25333790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University