View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15344_high_24 (Length: 221)
Name: NF15344_high_24
Description: NF15344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15344_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 43547335 - 43547520
Alignment:
| Q |
20 |
agattctagagggttcagggaagcctgtttgggctgttgtggtgtgcattgtagctgtttgcgctgatgtttcattcttttctattgggcttgggcctat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43547335 |
agattctagagggttcagggaagcctgtttgggctgttgtggtgtgcattgtagctgtttgcgctgatgtttcgttcttttctattgggcttgggcctat |
43547434 |
T |
|
| Q |
120 |
tacttgggtttattcgtcggagatttttcctatgaggcttagagctcaaggttcgagtattgcaatttcagtgaatcggttggtaa |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43547435 |
tacttgggtttattcttcggagatttttcctatgaggcttagagctcaaggttcgagtattgcaatttcagtgaatcggttggtaa |
43547520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 132
Target Start/End: Complemental strand, 33161484 - 33161454
Alignment:
| Q |
102 |
tattgggcttgggcctattacttgggtttat |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33161484 |
tattgggcttgggcctattacttgggtttat |
33161454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 73 - 156
Target Start/End: Complemental strand, 32830578 - 32830495
Alignment:
| Q |
73 |
gctgtttgcgctgatgtttcattcttttctattgggcttgggcctattacttgggtttattcgtcggagatttttcctatgagg |
156 |
Q |
| |
|
|||||||| |||| ||||||||| |||||||||||||||||||||| || ||||| ||||| || || ||||||||||||||| |
|
|
| T |
32830578 |
gctgtttgtgctgctgtttcatttttttctattgggcttgggcctacaacatgggtctattcatcagaaatttttcctatgagg |
32830495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University