View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15344_low_27 (Length: 275)
Name: NF15344_low_27
Description: NF15344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15344_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 261
Target Start/End: Original strand, 52112288 - 52112531
Alignment:
| Q |
16 |
tttgtattagtagtaaactatgcacatgtttaagaagaaacctagcctcttcatcaatggattttacaacaaaattaatttttgattaaactgcttgcat |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112288 |
tttgtattagtattaaactatgcacatgttgaagaagaaacctagcctc---atcaatggattttacaacaaaattaatttttgattaaactgcttgcat |
52112384 |
T |
 |
| Q |
116 |
cagtgattgtagtagcat-ggtgtgaaataaaacgcatattgtgtgcagtgtgctcaacaccctattgtgaagtcgttggaaatccaaattcatttgtgg |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52112385 |
tggtgattgtagtagcattggtgtgaaataaaacgcatattgtgtgcagtgtgctcaacaacctattgcgaagtcgttggaaatccaaattcatttgtgg |
52112484 |
T |
 |
| Q |
215 |
aatatgatttaccaactcaagagacattgcttgataacaatacacat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112485 |
aatatgatttaccaactcaagagacattgcttgataacaatacacat |
52112531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University