View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15344_low_31 (Length: 249)
Name: NF15344_low_31
Description: NF15344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15344_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 42 - 226
Target Start/End: Complemental strand, 6074450 - 6074266
Alignment:
| Q |
42 |
tgttctatgcacatatgcactatcagtagtaggaagatcaagtaaacaaaaacctaatttgttacaccctccatagcactaacaactctaatcaaaggtg |
141 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6074450 |
tgttctatgcacatatgcactaccagtagtaggaagatcaagtaaacaaaaacctaatttgttacaccctccatagcactaacaactctaatcaaaggtg |
6074351 |
T |
|
| Q |
142 |
tggcaggtgtccgataccaacacatgtgattatgtttatataatttattttctgagattatcaccggtgttcatgtgtcagtgtc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6074350 |
tggcaggtgtccgataccaacacatgtgattatgtttatataatttattttctgagattatcaccggtgttcatgtgtcagtgtc |
6074266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 85 - 206
Target Start/End: Complemental strand, 6074640 - 6074519
Alignment:
| Q |
85 |
aaacaaaaacctaatttgttacaccctccatagcactaacaactctaatcaaaggtgtggcaggtgtccgataccaacacatgtgattatgtttatataa |
184 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||| || ||| ||||||||||||||||| || ||||| | ||||||||||||||||| ||| | ||| |
|
|
| T |
6074640 |
aaacaaaaacctgattcgttacaccttccgtagtaccgacacctctaatcaaaggtgtgtcaagtgtctaacaccaacacatgtgattacgttcaactaa |
6074541 |
T |
|
| Q |
185 |
tttattttctgagattatcacc |
206 |
Q |
| |
|
|| ||||||| | ||||||||| |
|
|
| T |
6074540 |
ttcattttctcaaattatcacc |
6074519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 80
Target Start/End: Complemental strand, 6074695 - 6074657
Alignment:
| Q |
42 |
tgttctatgcacatatgcactatcagtagtaggaagatc |
80 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
6074695 |
tgttctatgcacatatgcattaccagtagtaggaagatc |
6074657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 192
Target Start/End: Complemental strand, 4793926 - 4793879
Alignment:
| Q |
145 |
caggtgtccgataccaacacatgtgattatgtttatataatttatttt |
192 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
4793926 |
caggtgtccgatactaacacatgtgattatgtttaattaattaatttt |
4793879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University