View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15344_low_32 (Length: 243)
Name: NF15344_low_32
Description: NF15344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15344_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 31 - 208
Target Start/End: Complemental strand, 28468780 - 28468603
Alignment:
| Q |
31 |
actgatggaaattagtgactaatgtttaagggttatgtctatttcataaagcatctctatcatatagtcattgggaataggtgtgagaaaaaacgaacac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28468780 |
actgatggaaattagtgactaatgtttaagggttatgtctatttcataaagcatctctatcatatagtcattgggaataggtgtgagaaaaaacgaacac |
28468681 |
T |
 |
| Q |
131 |
aaaagagataaattgccatttgaaggattgtttcacagaaaacaattgtgaaaactataacttacaaaagtagctgag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28468680 |
aaaagagataaattgccatttgaaggattgtttcacagaaaacaattgtgaaaactataacttacaaaagtagctgag |
28468603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University