View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15344_low_38 (Length: 203)
Name: NF15344_low_38
Description: NF15344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15344_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 3299659 - 3299471
Alignment:
| Q |
1 |
ttgtttgttttaagttgttgggtgcatttatcctcgtgttgatatttcgtcatatcgacaggaaatacagacatatggtatttacgcgaaagtgagctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
3299659 |
ttgtttgttttaagttgttgggtgcatttatcctcgtgttgatatttcgtcatatcgacaggaaatgcagacatatgatatttacg-gaaagtgagctgc |
3299561 |
T |
 |
| Q |
101 |
ttgttttctgatttttatttgaatttgtttttgctgtttagaaaaaccttcaagtcatgtgacatctatacttacacatatccaactgat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3299560 |
ttgttttctgatttttatttgaatttgtttttgctgtttagaaaaaccttcaagtcatgtgacatctatacttacacatatccaactgat |
3299471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University