View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15345_high_8 (Length: 234)
Name: NF15345_high_8
Description: NF15345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15345_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 31721689 - 31721469
Alignment:
| Q |
1 |
ttgtttatccaaacagaaaatagaaccagacacaacacaatatcatacactagttggtagtggcttcgagtgaactctacnnnnnnnnnnnnnntgtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31721689 |
ttgtttatccaaacagaaaatagaaccagacacaacacaatatcatacactagttggtagtggcttcgagtgaactctaccacacacacaca--tgtgga |
31721592 |
T |
 |
| Q |
101 |
taacacatcatgcctatttataagtattggtgattggagagcctaaagttctaaaataatatatgtttatttttacttttctacattacattcttataga |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31721591 |
taatacatcatgcctatttataagtattggtgattggagagcctaaagttctaaaataatatatgtttatttttacttttctacattacattattataga |
31721492 |
T |
 |
| Q |
201 |
tattgctaggctcttcagttcat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31721491 |
tattgctaggctcttcagttcat |
31721469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 31715815 - 31715600
Alignment:
| Q |
1 |
ttgtttatccaaacagaaaatagaaccagacacaacacaatatcatacactagttggtagtggcttcgagtgaactctacnnnnnnnnnnnnnntgtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||| |||| | |
|
|
| T |
31715815 |
ttgtttatccaaacagaaaatagaaccagacacagcacgatatcatacactagttggtagtggcttagagtgaactctac------cacacacttgtgaa |
31715722 |
T |
 |
| Q |
101 |
taacacatcatgcctatttataagtattggtgattggagagcctaaagttctaaaataatatatgtttatttttacttttctacattacattcttataga |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | || |||||||||||||||||||||| | ||| ||||||||| || ||| || ||||||| |
|
|
| T |
31715721 |
taacacatcatgcctatttacaagtattggtgct-------ccaaaagttctaaaataatatatgtctctttatacttttctgcaatactttattataga |
31715629 |
T |
 |
| Q |
201 |
tattgctaggctcttcagttcatctcact |
229 |
Q |
| |
|
|||| ||||||| ||||||||||||||| |
|
|
| T |
31715628 |
tatttttaggctcatcagttcatctcact |
31715600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 31700507 - 31700448
Alignment:
| Q |
1 |
ttgtttatccaaacagaaaatagaaccagacacaacacaatatcatacactagttggtagtg |
62 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||||||| |||||||| ||||| |
|
|
| T |
31700507 |
ttgtttatccaaacagaaaatagaaacagacac--cataatatcataaactagttgttagtg |
31700448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 95 - 132
Target Start/End: Complemental strand, 31700431 - 31700394
Alignment:
| Q |
95 |
tgtggataacacatcatgcctatttataagtattggtg |
132 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31700431 |
tgtgaataacacatcatgcctatttataagtattggtg |
31700394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University