View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15345_high_9 (Length: 223)
Name: NF15345_high_9
Description: NF15345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15345_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 5243230 - 5243014
Alignment:
| Q |
1 |
ctgacttctccatagtgctcagtcctcctttacgtcccatctcctgctacccttctgtccctagttgctccttccttgtctgccctcccttgctccttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5243230 |
ctgacttctccatagtgctcagtcctcctttacgtcccatctcctgatacccttctgtccctagttgctccttccttgtctgccctcccttgctccttcc |
5243131 |
T |
|
| Q |
101 |
tttaattaaacatcaaaaattagtatcaaattttaagtatataataatatgcattaatcataaactaatgtataaccttcagcaagatgttcctgagcct |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5243130 |
tttaattaaacaccaaaaattagtatcaaattttaagtatataataatatgcattaatcataaactaatgtataaccttcagcaagatgttcctgagcct |
5243031 |
T |
|
| Q |
201 |
caaggctcttgccacca |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5243030 |
caaggctcttgccacca |
5243014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 88
Target Start/End: Original strand, 25523036 - 25523121
Alignment:
| Q |
3 |
gacttctccatagtgctcagtcctcctttacgtcccatctcctgctacccttctgtccctagttgctccttccttgtctgccctcc |
88 |
Q |
| |
|
||||| |||||||| || |||||||||||||| ||||| || || ||||||||| |||| | ||||| ||||||||||||||||| |
|
|
| T |
25523036 |
gacttatccatagtactgagtcctcctttacggcccatttcttgatacccttctctccccatctgctctttccttgtctgccctcc |
25523121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University