View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15346_high_14 (Length: 212)
Name: NF15346_high_14
Description: NF15346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15346_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 48482568 - 48482752
Alignment:
| Q |
14 |
aacctgtgaactgcacaatatattagcgtctgtgttatttgagtccccttcttcactgtagaacgcaactgtacatttaaacaatatcaacatattttcc |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482568 |
aacctgtgaactgcgcaatatattagcgtctgtgttatttgagtccccttcttcactgtagaacgcaactgtacatttaaacaatatcaacatattttcc |
48482667 |
T |
 |
| Q |
114 |
cagcagcggaagtaatagccatgtaactaaatgcttacttccataaaaatctatatattgattatggacataaatgactttgctg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482668 |
cagcagcggaagtaatagccatgtaactaaatgcttacttccataaaaatctatatattgattatggacataaatgactttgctg |
48482752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University