View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15346_low_12 (Length: 290)
Name: NF15346_low_12
Description: NF15346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15346_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 70 - 189
Target Start/End: Original strand, 24078696 - 24078815
Alignment:
| Q |
70 |
gcatagaagctactatgaagtttcttcctcacttctttttgctcatttccacaatgaaaatggtgaaaattgctcttccttctggtaaaatggagatcaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24078696 |
gcatagaagctactatgaagtttcttcctcacttctttttgctcatttccacaatgaaaatggtgaaaattgctcttccttctggtaaaatggagatcaa |
24078795 |
T |
 |
| Q |
170 |
atatctttcactctctctga |
189 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24078796 |
atatctttcactctctctga |
24078815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University