View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15346_low_14 (Length: 242)
Name: NF15346_low_14
Description: NF15346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15346_low_14 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 5678710 - 5678951
Alignment:
| Q |
1 |
tgctagttgagttgaaaagttttagggaataatgaggatagagtacttagaatttgaacctcaaatcaaataaatttgtatgcaatgttaatccaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678710 |
tgctagttgagttgaaaagttttagggaataatgaggatagagtacttagaatttgaacctcaaatcaaataaatttgtatgcaatgttaatccaagaaa |
5678809 |
T |
|
| Q |
101 |
tatttgaccttgtgaatttcccaaacaaggtcttcttatctagaagaaaggtaattctctggagggtagaggaaggaatatgagtggtattatagacatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678810 |
tatttgaccttgtgaatttcccaaacaaggtcttcttatctagaagaaaggtaattctctggagggtagaggaaggaatatgagtggtattatagacatt |
5678909 |
T |
|
| Q |
201 |
atgaaatgaaaggaagggcaatatacaagaatggagatgtac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678910 |
atgaaatgaaaggaagggcaatatacaagaatggagatgtac |
5678951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University