View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15346_low_16 (Length: 234)
Name: NF15346_low_16
Description: NF15346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15346_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 23 - 225
Target Start/End: Original strand, 5094345 - 5094537
Alignment:
| Q |
23 |
aaaatatgttggtagcatataagaatcaagaattgtatttgcctttcaatattttgatatattctgcagataccacgttaacttaactatgaagaataat |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5094345 |
aaaaaatgttggtagcatataagaatcaagaattgtatttgcctttcaatattttg----------cagataccacgttaacttaactatgaagaataat |
5094434 |
T |
|
| Q |
123 |
tagaaaaataatttatttatatatcattaaacaattagtttgattaaattgaagctctaaaatttattagaaatgtaagggagtatacgatttttatatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5094435 |
tagaaaaataatttatttatatatcattaaacaattagtttgattaaattgaagttctaaaatttattagaaatgtaagggagtatacgatttttatttt |
5094534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University