View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15347_high_9 (Length: 290)
Name: NF15347_high_9
Description: NF15347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15347_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 22 - 274
Target Start/End: Original strand, 30785726 - 30785973
Alignment:
| Q |
22 |
agaagagagaagcagatagaagagcaactagagctgcactagacactgattcacccaatgataatgtgagtttctgagatgcttggtgattttgttttgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30785726 |
agaagagagaagcagatagaagagcaactagagctgcactagacactgattcacccaatgataatgcgagtttctgagatgcttggtgattttgttttgg |
30785825 |
T |
 |
| Q |
122 |
attggttccctgtgaagagtagtagagtgaaaattattaaacttgaataagagnnnnnnnntgattcatgaatataaacttgtatagtatagtatagtat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30785826 |
attggttccctgtgaagagtagtagagtgaaaattattaaacttgaataagagaaaaaaaatgattcatgaatataaactt-----gtatagtatagtat |
30785920 |
T |
 |
| Q |
222 |
acgaaccagaaacagagaaagaggagttggtgagctggttgaagaggaaggtg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785921 |
acgaaccagaaacagagaaagaggagttggtgagctggttgaagaggaaggtg |
30785973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University