View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15347_low_13 (Length: 290)

Name: NF15347_low_13
Description: NF15347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15347_low_13
NF15347_low_13
[»] chr3 (1 HSPs)
chr3 (22-274)||(30785726-30785973)


Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 22 - 274
Target Start/End: Original strand, 30785726 - 30785973
Alignment:
22 agaagagagaagcagatagaagagcaactagagctgcactagacactgattcacccaatgataatgtgagtttctgagatgcttggtgattttgttttgg 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
30785726 agaagagagaagcagatagaagagcaactagagctgcactagacactgattcacccaatgataatgcgagtttctgagatgcttggtgattttgttttgg 30785825  T
122 attggttccctgtgaagagtagtagagtgaaaattattaaacttgaataagagnnnnnnnntgattcatgaatataaacttgtatagtatagtatagtat 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||     ||||||||||||||    
30785826 attggttccctgtgaagagtagtagagtgaaaattattaaacttgaataagagaaaaaaaatgattcatgaatataaactt-----gtatagtatagtat 30785920  T
222 acgaaccagaaacagagaaagaggagttggtgagctggttgaagaggaaggtg 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
30785921 acgaaccagaaacagagaaagaggagttggtgagctggttgaagaggaaggtg 30785973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University