View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15347_low_14 (Length: 273)
Name: NF15347_low_14
Description: NF15347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15347_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 48980548 - 48980318
Alignment:
| Q |
19 |
atagagacttatgcaaatacaatgcaa-gtgagacagctgggctagcttgaccctattatattggcattgctgcacagataatgctaagcatctttgctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48980548 |
atagagacttatgcaaatacaatgcaaagtgagacagctgggctagcttgaccctattatattggcattgctgcacagataatgctaagcatctttgctg |
48980449 |
T |
 |
| Q |
118 |
tttgattagattgcactacctatctactactg-ggcgcaataagactttgtcttcttgtcattgaaatgaaattgaaaaggcatcactcaaa-----taa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48980448 |
tttgattagattgcactacctatctactactgctgcccaataagactttgtcttcttgtcattgaaatgaaattgaaaaggcatcactcaaataaattaa |
48980349 |
T |
 |
| Q |
212 |
ataaattaatttcaacactattatcattcca |
242 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
48980348 |
attaattaatttcaacactattatcattcca |
48980318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University