View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15347_low_6 (Length: 406)
Name: NF15347_low_6
Description: NF15347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15347_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 91 - 399
Target Start/End: Original strand, 23171475 - 23171781
Alignment:
| Q |
91 |
taactgcgtcttgcaatgatacagtatatggcaataaccagcagcaccaagttgttacggggcacttgaatagctgtcatgatttaaaatttaaacccca |
190 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
23171475 |
taactgcgtctgccaatgatacagtatatggcaataaccagcagcaccaagttgttacggggcacttgaattgctgtcatgatttaaaatttcaacccca |
23171574 |
T |
|
| Q |
191 |
atcatgtccaaatcaaaatcacaatcatgattgcgaccatattaactctgctttgtatttggataaaggtcgtcgcaacttgcaagcataactatcatca |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23171575 |
atcatgtccaaatcaaaatcacaatcatgattgcgaccatattaactctgctttgtatttgg--aaaggtcgtcgcaacttgcaagcataactatcatca |
23171672 |
T |
|
| Q |
291 |
cattgtaaacacaacaacagtttaaaaggatttggattcactgtagctcatgctcctaattactagcattcttatcacaagatcaatttttacgcattcg |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
23171673 |
cattgtaaacacaacaacagtttaaaaggatttggattcactgtagctcatgctcctaattacaagcattcttatcacaagatcagtttttaggcattcg |
23171772 |
T |
|
| Q |
391 |
ttcatctca |
399 |
Q |
| |
|
||||||||| |
|
|
| T |
23171773 |
ttcatctca |
23171781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 23171380 - 23171425
Alignment:
| Q |
1 |
tgctaaggcgtcaactcaacttacttatttttattattaccggttc |
46 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23171380 |
tgctaatgcgccaactcaacttacttatttttattattaccggttc |
23171425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University