View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15348_low_10 (Length: 275)
Name: NF15348_low_10
Description: NF15348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15348_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 145 - 260
Target Start/End: Original strand, 23807308 - 23807423
Alignment:
| Q |
145 |
agatatctttagtgtatcttgcttgaagttagagatttcttgatacgaattttctactcgaactctatcacctcgaagacaatattttcattgaagacga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23807308 |
agatatctttagtgtatcttgcttgaagttagagatttcttgatacaaattttctactcaaactctatcacctcgaagacaatattttcattgaagacga |
23807407 |
T |
|
| Q |
245 |
tgctttttggaacttg |
260 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
23807408 |
tgctttttgaaacttg |
23807423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 13 - 81
Target Start/End: Original strand, 23806584 - 23806652
Alignment:
| Q |
13 |
aaaatattgaagcacatgcattacacatattggaacaactttttgcatgtcacgtgatgtgcatatata |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23806584 |
aaaatattgaagcacatgcattacacatattggaacaactttttgcatgtcacgtgatgtgcatatata |
23806652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University