View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15349_high_11 (Length: 227)
Name: NF15349_high_11
Description: NF15349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15349_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 138
Target Start/End: Complemental strand, 28634339 - 28634212
Alignment:
| Q |
18 |
atatatgaagaaatatagaaatgtttttgaattgataatgtcctttggactata--------tatacttagtgtagtatagtacgatagtatactttttt |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28634339 |
atatatgaa-aaatatagaaatgtttttgaattgataatgtcctttggactataatactatatatacttagtgtagtatagtacgatagtattctttttt |
28634241 |
T |
|
| Q |
110 |
attaaattgatgatgtcctttatattata |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28634240 |
attaaattgatgatgtcctttatattata |
28634212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 130 - 209
Target Start/End: Complemental strand, 28633719 - 28633640
Alignment:
| Q |
130 |
tatattatatatttttagaaattatactgtagaatatattaacttattaaagttcatatggaattatttatcacatgtct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28633719 |
tatattatatatttttagaaattatactgtagaatatattaaattattaaagttcatatggaattatttatcacatgtct |
28633640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University