View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15349_high_15 (Length: 208)
Name: NF15349_high_15
Description: NF15349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15349_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 45097034 - 45096837
Alignment:
| Q |
1 |
ttcattctattcacatttacagagcagtaaatcaatgtgctgattagcttgctaatcttcgtttaagtttgagttcttatgcttggtggtctcagttgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45097034 |
ttcattctattcacatttacagagcagtaaatcaacgtgctgattagcttgctaatcttcgtttaagtttgagttcttatgcttggtggtttcagttgcc |
45096935 |
T |
 |
| Q |
101 |
taaccaaattagagacgattatattagaaatagattaggttttgcaatttacgattttgttagctctttgtgagggtttgttcttatatcccattctt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
45096934 |
taaccaaattagagacgactatattagaaatagattaggttttacaatttacgattttgttagctctttttgagggtttggtcttatatcccattctt |
45096837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University