View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15349_low_10 (Length: 287)
Name: NF15349_low_10
Description: NF15349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15349_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 107 - 279
Target Start/End: Original strand, 27344012 - 27344183
Alignment:
| Q |
107 |
aatatggaatgattcctttaaaataagcttaagctatgctatgcttgatttgaactagagccaagacatttgaatttagtggtttctagttgttatgttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27344012 |
aatatggaatgattcctttaaaataagcttaagctatgttatgcttgatttgaaatagagccaagacatttgaatt-agtggtttctagttgttatgttt |
27344110 |
T |
 |
| Q |
207 |
tcattcaaagaatgggaaattgtgaataaaatcagtataagggtgctttgcttcaagcattattgtgatccat |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27344111 |
tcattcaaagaatgggaaattgtgaataaaatcagtataagggtgctttgcttcaagcattattgtgatccat |
27344183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University