View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15349_low_16 (Length: 250)
Name: NF15349_low_16
Description: NF15349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15349_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 4770387 - 4770611
Alignment:
| Q |
18 |
tttacaacatgtgtagacaaattcattcttaaccctgtctcccaaagttgatatttcttcccttaccaattgtagttgaagtttatcaagagtttgtctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4770387 |
tttacaacatgtgtagacaaattcattcttaaccctgtctcccaaagttgatatttcttcccttaccaattgtagttgaagtttatcaagagtttgtctt |
4770486 |
T |
|
| Q |
118 |
agatcagatagaagttctggtcgataatcgcagctgatagatgctttgtaaagaaatgatccaccattttcatatggttcaactttcacttcatcgtcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
4770487 |
agatcagatagaagttctggtcgataatcgcagctgatagatgctttgtaaagaaatgatccaccattttcatatggttcaactttcacttcatcatcgt |
4770586 |
T |
|
| Q |
218 |
ctgttgggattgaataacctttgct |
242 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
4770587 |
ctgttggaattgaataacctttgct |
4770611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University