View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15349_low_21 (Length: 225)
Name: NF15349_low_21
Description: NF15349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15349_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 15 - 128
Target Start/End: Complemental strand, 38051606 - 38051494
Alignment:
| Q |
15 |
atgaagtatacgtgaggaggatcaatgaggacaaggtatgcattaccaaaagctggtaagtgttgcaatatgtacggtggaatgcatgaggaaatgctac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051606 |
atgaagtatacgtgaggaggatcaatgaggacaaggtatgcattaccaaa-gctggtaagtgttgcaatatgtacggtggaatgcatgaggaaatgctac |
38051508 |
T |
|
| Q |
115 |
cacgtgtctctctc |
128 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38051507 |
cacgtgtctctctc |
38051494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University