View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1534_high_3 (Length: 252)

Name: NF1534_high_3
Description: NF1534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1534_high_3
NF1534_high_3
[»] chr8 (2 HSPs)
chr8 (21-241)||(395796-396015)
chr8 (191-228)||(30483902-30483939)
[»] chr3 (1 HSPs)
chr3 (191-227)||(36720402-36720438)
[»] chr2 (2 HSPs)
chr2 (190-230)||(23140928-23140968)
chr2 (190-230)||(23552718-23552758)


Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 395796 - 396015
Alignment:
21 gtagggttttgagagattcgagtgtcatggttatatggttttagggggaagtggaaatggaaatgaataagaataagaaaatagagtttgaacattataa 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
395796 gtagggttttgagagattcgagtgtcatggttatatggttttagggggaagtggaaatggaaatgaataagaataagaaaatagagtttgaacattataa 395895  T
121 gctatatacnnnnnnnngtaaacagttatgaagaacttacgagaataagataaaaacaatgttcggcctatggtattggcttggcatatgggagtgtgtt 220  Q
    |||||||||        ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
395896 gctatatac-tttttttgtaaacagttatgaagaacttaccagaataagataaaaacaatgtttggcctatggtattggcttggcatatgggagtgtgtt 395994  T
221 cctcctcaattcgattctctc 241  Q
    |||||||||||||||||||||    
395995 cctcctcaattcgattctctc 396015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 191 - 228
Target Start/End: Complemental strand, 30483939 - 30483902
Alignment:
191 tggtattggcttggcatatgggagtgtgttcctcctca 228  Q
    |||||||||||||| ||||||||||||| |||||||||    
30483939 tggtattggcttgggatatgggagtgtgctcctcctca 30483902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Original strand, 36720402 - 36720438
Alignment:
191 tggtattggcttggcatatgggagtgtgttcctcctc 227  Q
    |||||||||||||| ||||||||||||| ||||||||    
36720402 tggtattggcttgggatatgggagtgtgctcctcctc 36720438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Complemental strand, 23140968 - 23140928
Alignment:
190 atggtattggcttggcatatgggagtgtgttcctcctcaat 230  Q
    ||||||||||||||| | ||||| |||||||||||||||||    
23140968 atggtattggcttgggacatgggtgtgtgttcctcctcaat 23140928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Complemental strand, 23552758 - 23552718
Alignment:
190 atggtattggcttggcatatgggagtgtgttcctcctcaat 230  Q
    ||||||||||||||| | ||||| |||||||||||||||||    
23552758 atggtattggcttgggacatgggtgtgtgttcctcctcaat 23552718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University