View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1534_low_1 (Length: 301)
Name: NF1534_low_1
Description: NF1534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1534_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 38 - 290
Target Start/End: Original strand, 34330729 - 34330981
Alignment:
| Q |
38 |
agtgatgttatattagtttagtatacttgtaactagaaaagctgagttcagatgaaattgaaatgaatctgagaaaactactaggttgtgttgttggttg |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330729 |
agtgatgttatattagtttagtatacttgtaactagaaaagctgagttcagatgaaattgaaatgaatctgagaaaactactaggttgtgttgttggttg |
34330828 |
T |
|
| Q |
138 |
cttatgaaattccttttgctttcatatatatgtgtttcaggtctgtgtaccaatttgtcctgtcaccaattataaagctgttgaaaccaaacatgtcata |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330829 |
cttatgaaattccttttgctttcatatatatgtgtttcaggtctgtgtaccaatttgtcctgtcaccaattataaagctgttgaaaccaaacatgtcata |
34330928 |
T |
|
| Q |
238 |
ttctctttaccctaccttttttccttactcttcaatgaaacaaattcccagcc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330929 |
ttctctttaccctaccttttttccttactcttcaatgaaacaaattcccagcc |
34330981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University